RNA virus

An RNA virus is a virus that has RNA (ribonucleic acid) as its genetic material. This nucleic acid is usually single-stranded RNA (ssRNA) but may be double-stranded RNA (dsRNA). The ICTV classifies RNA viruses as those that belong to Group III, Group IV or Group V of the Baltimore classification system of classifying viruses, and does not consider viruses with DNA intermediates as RNA viruses. Notable human diseases caused by RNA viruses include SARS, influenza and hepatitis C.
Another term for RNA viruses that explicitly excludes retroviruses is ribovirus.

Characteristics

Single-stranded RNA viruses and RNA Sense

RNA viruses can be further classified according to the sense or polarity of their RNA into negative-sense and positive-sense, or ambisense RNA viruses. Positive-sense viral RNA is similar to mRNA and thus can be immediately translated by the host cell. Negative-sense viral RNA is complementary to mRNA and thus must be converted to positive-sense RNA by an RNA polymerase before translation. As such, purified RNA of a positive-sense virus can directly cause infection though it may be less infectious than the whole virus particle. Purified RNA of a negative-sense virus is not infectious by itself as it needs to be transcribed into positive-sense RNA, however each virion can be transcribed to several positive-sense RNAs. Ambisense RNA viruses resemble negative-sense RNA viruses, except they also translate genes from the positive strand.

RNA - Transcription

Click for larger image	RNA - Transcription Introduction: The differences in the composition of RNA and DNA have already been noted. In addition, RNA is not usually found as a double helix but as a single strand. However, the single polynucleotide strand may fold back on itself to form portions which have a double helix structure like the tertiary structure of proteins. The biosynthesis of RNA, called transcription, proceeds in much the same fashion as the replication of DNA and also follows the base pairing principle. Again, a section of DNA double helix is uncoiled and only one of the DNA strands serves as a template for RNA polymerase enzyme to guide the synthesis of RNA. After the synthesis is complete, the RNA separates from the DNA and the DNA recoils into its helix. The transcription of a single RNA strand is illustrated in the graphic on the left. One major difference is that the heterocyclic amine, adenine, on DNA codes for the incorporation of uracil in RNA rather than thymine as in DNA. Remember that thymine is not found in RNA and do not confuse the replacement of uracil in RNA for thymine in DNA in the transcription process. For example, thymine in DNA still codes for adenine on RNA not uracil, while the adenine on DNA codes for uracil in RNA. Note that the new RNA (red) is identical to non coding DNA with the exception of uracil where thymine was located in DNA. There are three major types of RNA which will be fully explained in a later section. Although RNA is synthesized in the nucleus, it migrates out of the nucleus into the cytoplasm where it is used in the synthesis of proteins. Quiz: Transcribe RNA from a strand of DNA: A G C T G T A C A More details: Yeast RNA Polymerase II Elongation Complex Credit: Gnatt, A. L., Cramer, P., Fu, J., Bushnell, D. A., Kornberg, R. D. (2001) "Structural Basis of Transcription: An RNA Polymerase II Elongation Complex at 3.3 Å Resolution" Science 292:1876.
Click for larger image	RNA Transcription Process: The RNA transcription process occurs in three stages: initiation, chain elongation, and termination. The first stage occurs when the RNA Polymerase-Promoter Complex binds to the promoter gene in the DNA. This also allows for the finding of the start sequence for the RNA polymerase. The promoter enzyme will not work unless the sigma protein is present (shown in blue in graphic). Specific sequences on the non coding strand of DNA are recognized as the signal to start the unwinding process. The recognition sequences are as follows: Non-coding DNA -5' recognition sections in bold GGCCGCTTGACAAAAGTGTTAAATTGTGCTATACT Once the process has been initiated, then the RNA polymerase elongation enzyme takes over and is described in the next panel. RNA Polymerase - Promoter Complex - Chime in new window Note: The coordinates used in this display have only the alpha carbons of the proteins (CA) and the DNA backbone atoms. Thus, Backbone and Spacefill are the only Chime display options available. Link with more details - RNA Polymerase - Promoter Complex Credit: Murakami, K. S., Masuda, S., Campbell, E. A., Muzzin, O., Darst, S. A. (2002) "Structural Basis of Transcription Initiation: An RNA Polymerase Holoenzyme-DNA Complex "Science 2961285.
Click for larger image	RNA Polymerase - Elongation: The elongation begins when the RNA polymerase "reads" the template DNA. Only one strand of the DNA is read for the base sequence. The RNA which is synthesized is the complementary strand of the DNA. The RNA (top strand) and DNA (bottom strand) sequences in the model are: 5' -GACCAGGCA-3' 3'-TCTGGTCCGTAAA-5' In the graphic, the magenta color is the template DNA, while the green is the RNA strand. In the next reaction step, uracil triphosphate (UTP) is the next to be added to the RNA by bind and pairing with the adenine (A) nucleotide on the template DNA strand. A phosphodiester bond is formed; the RNA chain is than elongated to 10 nucleotides; and diphosphate left over would dissociate. Note: The coordinates used in this display have only the alpha carbons of the proteins

RNA Transcription by RNA Polymerase: Prokaryotes vs Eukaryotes

By: Suzanne Clancy, Ph.D. © 2008 Nature Education 

Citation: Clancy, S. (2008) RNA transcription by RNA polymerase: prokaryotes vs eukaryotes. Nature Education 1(1)

Gene expression is linked to RNA transcription, which cannot happen without RNA polymerase. However, this is where the similarities between prokaryote and eukaryote expression end.

Aa Aa Aa

Every nucleated, diploid cell in the body contains the same DNA, or genome, yet different cells appear committed to different specialized tasks—for example, kidney cells absorb sodium, while pancreatic cells produce insulin. How is this possible? The answer lies in differential use of the genome; in other words, different cells within the body express different portions of their DNA. This process, which begins with the transcription of DNA into RNA, ultimately leads to changes in cell function. Changes in transcription are thus a fundamental means by which cell function is regulated across species. In fact, even single-celled organisms, such as bacteria, regulate gene transcription depending on cues in their environments. Therefore, understanding how transcription is regulated is fundamental to deciphering the mysteries of the genome.

Central to the process of transcription is the complex of proteins known as the RNA polymerases. RNA polymerases have been found in all species, but the number and composition of these proteins vary across taxa. For instance, bacteria contain a single type of RNA polymerase, while eukaryotes (multicellular organisms and yeasts) contain three distinct types. In spite of these differences, there are striking similarities among transcriptional mechanisms. For example, all species require a mechanism by which transcription can be regulated in order to achieve spatial and temporal changes in gene expression. In order to fully understand what this means, it is first necessary to examine the mechanisms of RNA transcription in more detail.

Transcription: An Overview

In all species, transcription begins with the binding of the RNA polymerase complex (or holoenzyme) to a special DNA sequence at the beginning of the gene known as the promoter. Activation of the RNA polymerase complex enables transcription initiation, and this is followed by elongation of the transcript. In turn, transcript elongation leads to clearing of the promoter, and the transcription process can begin yet again. Transcription can thus be regulated at two levels: the promoter level (cis regulation) and the polymerase level (trans regulation). These elements differ among bacteria and eukaryotes.

Transcription in Bacteria

In bacteria, all transcription is performed by a single type of RNA polymerase. This polymerase contains four catalytic subunits and a single regulatory subunit known as sigma (s). Interestingly, several distinct sigma factors have been identified, and each of these oversees transcription of a unique set of genes. Sigma factors are thus discriminatory, as each binds a distinct set of promoter sequences.

A striking example of the specialization of sigma factors for different gene promoters is provided by bacterial sporulation in the species Bacillus subtilis. This bacterium exists in two states: vegetative (growing) and sporulating. Genes involved in spore formation are not normally expressed during vegetative growth. Remarkably, expression of a gene encoding a novel sigma factor turns on the first genes for sporulation. Subsequent expression of different sigma factors then turns on new sets of genes needed later in the sporulation process (Losick & Stragier, 1992). Each of these sigma factors recognizes the promoters of the genes in its group, not those "seen" by other sigma factors. This simple example illustrates how transcription can be regulated in both cis and trans to cause changes in cell function. Therefore, while bacteria accomplish transcription of all genes using a single kind of RNA polymerase, the use of different sigma factor subunits provides an extra level of control.

Transcription in Eukaryotes

"Christmas tree-like" structures can be visualized during active transcription.

Yeast strains conditionally expressing either the U3 snoRNA or Utp7 from a galactose promoter were used to make the chromatin spreads.

 

 

Eukaryotic cells are more complex than bacteria in many ways, including in terms of transcription. Specifically, in eukaryotes, transcription is achieved by three different types of RNA polymerase (RNA pol I-III). These polymerases differ in the number and type of subunits they contain, as well as the class of RNAs they transcribe; that is, RNA pol I transcribes ribosomal RNAs (rRNAs), RNA pol II transcribes RNAs that will become messenger RNAs (mRNAs) and also small regulatory RNAs, and RNA pol III transcribes small RNAs such as transfer RNAs (tRNAs).

Because RNA pol II transcribes protein-encoding genes, it has been of particular importance to scientists who study the regulation of eukaryotic gene expression, and its function is well understood. For example, researchers know that RNA pol II can bind to a DNA sequence within the promoter of many genes, known as the TATA box, to initiate transcription. Together with other common motifs (short recognition sequences in the DNA), these elements constitute the core promoter. However, changes in RNA pol II affinity and, therefore, gene expression can be influenced by surrounding DNA sequences (enhancers), which in turn recruit transcription factors. While these properties of transcription regulation are very important, they remain an area of active research. Interestingly, RNA pol II is uniquely sensitive to amatoxins, such as a-amanitin of the extremely toxic Amanita genus of mushrooms (Weiland, 1968), a fact that researchers have been able to exploit for the purposes of polymerase studies - although recreational mushroom hunters should beware! Thus, while eukaryotic transcription is far more complex than bacterial transcription, the main difference between the two types of transcription lies in RNA polymerase.